PipeCraft2
  • Installation
  • QuickStart
  • Pre-defined pipelines
  • Individual steps (Quick Tools)
  • Post-processing tools
  • Example data analyses
    • Inspect quality profiles
    • DADA2 ASVs pipeline, 16S
    • DADA2 ASVs pipeline, COI
    • DADA2 ASVs pipeline, ITS2
    • vsearch OTUs pipeline, ITS2
    • OptimOTU pipeline, ITS2
      • Starting point
      • Target taxa and sequence orientation
      • Control sequences
      • Cut primers and trim reads
      • Quality filtering
      • Denoising and merging paired-end reads
      • Chimera filtering
      • Filter tag-jumps
      • Amplicon model setting
      • Protax classification
      • Clustering
      • Save workflow
      • Start the workflow
      • Examine the outputs
  • Troubleshooting
  • Licence
  • How to cite
  • Releases
  • Docker images
  • Contact and Acknowledgements
  • For Developers
PipeCraft2
  • Example data analyses
  • OptimOTU pipeline, ITS2
  • View page source

OptimOTU pipeline, ITS2 PipeCraft2_logo

This example data analyses follows OptimOTU workflow as implemented in PipeCraft2’s pre-compiled pipelines panel.

Download example data set here (4.1 Mb) and unzip it.
This is paired end Illumina dataset, ITS2 amplicons.

Note

OptimOTU pipeline is not much customizable; most important parametes to check/specify are the primers (CUT PRIMERS AND TRIM READS panel) and model file (AMPLICON MODEL SETTINGS panel)


Starting point

This example dataset consists of ITS2 rRNA gene amplicon sequences; targeting fungi:

  • paired-end Illumina MiSeq data;

  • demultiplexed set (per-sample fastq files);

  • primers are not removed;

  • sequences in this set are 5’-3’ (fwd) oriented.

Required directory structure for OptimOTU
 my_dir/
 └── sequences/         # SELECT THIS FOLDER AS WORKING DIRECTORY (name here can be anything)
     └── 01_raw/
         ├── Run1/      # name here can be anything (without spaces)
         │   ├── sample1_R1.fastq.gz
         │   ├── sample1_R2.fastq.gz
         │   ├── sample2_R1.fastq.gz
         │   └── sample2_R2.fastq.gz
         ├── Run2/      # name here can be anything (without spaces)
         │   ├── sample3_R1.fastq.gz
         │   ├── sample3_R2.fastq.gz
         │   ├── sample4_R1.fastq.gz
         │   └── sample4_R2.fastq.gz
         └── Run3/      # name here can be anything (without spaces)
             ├── sample5_R1.fastq.gz
             └── sample5_R2.fastq.gz

To select OptimOTU pipeline, press
SELECT PIPELINE –> OptimOTU.

To select input data, press SELECT WORKDIR
and specify
sequence files extension as *.fastq.gz;
sequencing read types as paired-end.

Target taxa and sequence orientation

Here we are specifying that target taxa is fungi, and sequence orientation is fwd.


Control sequences

Control sequences are sequences that are not target taxa, but are used to estimate the error rate of the sequencing.


Cut primers and trim reads

The example dataset contains primer sequences. Generally, we need to remove these to proceed the analyses only with the variable metabarcode of interest. If there are some additional sequence fragments, from eg. sequencing adapters or poly-G tails, then clipping the primers will remove those fragments as well.

For the example data, the forward primer is ITS3 GCATCGATGAAGAACGCAGC and reverse primer is ITS4 TCCTCCGCTTATTGATATGC.


Quality filtering

Quality filtering here removes sequences which does not meet the threshold for the allowed maximum number of expected errors. See here for more inforamtion about sequence quality and here for the additional information about expected errors.


Denoising and merging paired-end reads

The denoising step are performed using the DADA2 package (Callahan et al. 2016) with default parameters optimized for Illumina amplicon data. Error profiles are learned separately for each sequencing run. Denoising is performed using the dada() function, and read pairs are merged using the mergePairs() function. There are no adjustable settings here.


Chimera filtering

The chimera filtering step is performed using the DADA2 package (Callahan et al. 2016) with default parameters (consensus method). There are no adjustable settings here.


Filter tag-jumps

Tag-jump events are evaluated the UNCROSS2 algorithm (Edgar 2018) are removed. The expected tag-jump rate (f-value) and the severity of the removal (p-value) can be specified. Here for dual-indexes and combinational indexing strategy (e.g. indexFwd_1-indexRev_1 and indexFwd_1-indexRev_2), we are using the default values: - f-value of 0.03 - p-value of 1

For single-indexes, use f-value of >=0.05.


Amplicon model setting

This example dataset has been generated usign primers ITS3-ITS4 for fungi, thus we are using the model_file = ITS3_ITS4.cm. And the model_type = CM.


Protax classification

For fungi, a built-in database for protax classification can be used.

location = protaxFungi [Or specify a directory where protax is located.] with_outgroup = UNITE_SHs this is an additionalonal database which contains also outgroup (non-target) sequences from the same locus. For fungi, default is UNITE_SHs, which is sh_matching_data_0_5_v9 sequences (included in the PipeCraft2 container)


Clustering

cluster thresholds = Fungi_GSSP this is the default pre-calculated thresholds for fungi


Save workflow

Once we have decided about the settings in our workflow, we can save the configuration file by pressing save workflow button on the right-ribbon save

If you forget the save, then no worries, a pipecraft2_last_run_configuration.json file will be generated for you upon starting the workflow. As the file name says, it is the workflow configuration file for your last PipeCraft run in this working directory.

This JSON file can be loaded into PipeCraft2 to automatically configure your next runs exactly the same way.


Start the workflow

Press START on the left ribbon to start the analyses.

when running the module for the first time …

… a docker image will be first pulled to start the process.

For example: pulling_image

When you need to STOP the workflow, press STOP button stop_workflow

When the workflow has completed …

… a message window will be displayed.

workflow_finished


Examine the outputs

Several process-specific output folders are generated output_icon

Output file

Description

asv_table

ASV table as a sparse matrix (long format) with five columns:
sample, seqrun, seq_id, seq_idx, and nread
asv2tax_<conf>

Taxonomic assignments for each ASV at the 50% (plausible)
and 90% (reliable) probability thresholds <conf>
otu_taxonomy_<conf>

Taxonomy for each OTU at the 50% (plausible) and 90% (reliable)
probability thresholds <conf>
otu_table_sparse_*

OTU table as a sparse matrix (long format) with five columns:
sample, seqrun, seq_id, seq_idx, and nread
otu_table_<conf>

OTU table as a dense matrix (wide format) with columns as samples
and rows as OTUs
otu_<conf>.fasta

Representative OTU sequences for the 50% (plausible) and 90% (reliable)
probability thresholds <conf>
read_counts_<conf>.tsv || The number of reads in each sample present after each stage
|| of the pipeline

optimotu_targets.log

R log file about the OptimOTU pipeline

Previous Next

© Copyright 2025, Sten Anslan.

Built with Sphinx using a theme provided by Read the Docs.